Barcode Identifiers

Sequence ID: ZYPAN929-10
Sample ID: CNCLEP00075199
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 582
AACTTTATATTTTATTTTTGGAATTTGAAGAGGAATAGTAGGAACATCTCTAAGATTATTAATTCGGGCTGAATTAGGTAATCCCGGATCATTAATTGGAGATGATCAAATTTATAACACAATCGTAACTGCTCATGCATTTATTATAATTTTCTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTTGTACCATTAATATTAGGAGCCCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACTGTGTATCCCCCACTCTCATCTAATATTGCTCATGGTGGAAGATCTGTAGATTTAGCAATTTTTTCCCTTCATTTAGCCGGTATTTCTTCTATTCTAGGAGCAATTAATTTTATTACCACTATTATTAACATAAAAATTAATGGTATATCCTTTGATCAAATACCATTATTTGTTTGAGCTGTTGGTATTACAGCTTTATTATTATTACTATCCCTTCCTGTATTAGCAGGAGCTATTACTATACTTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||