Barcode Identifiers

Sequence ID: WSF280-09
Sample ID: 5WL1IIIC3
Identified As:
Last Updated
Marker ITS

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser. Sorry!

Sequencing Runs (Reverse)

If you see this text, it means that you are not using a java capable browser. Sorry!

Nucleotide Sequence

Residues: 552
GAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTACTATAACTCATAACCCTTTGTGAACCTTCATACCTGTTGCTTCGGCGGCGCGCCTCCCGGGGCGTGCCCGCCGGCATTATCAGAATCTCTGTTCGAACCCGACGATACTTCTGAGTGTTCTAAGCGAACTGTTAAAACTTTCAACAACGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATGGCGCCTTCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCCGTGGCCCGGCGTTGGGGACCTGCCCAGGCAGTCCCCGAAAACCAGTGGCGGACCCGACGGGCCCTTCCTTTGCGTAGTAACATCTGCCTCGCATCGGGAGCCCCCGGGCTATCCGGCCTCTAAACCCCCCTCAAGCCCGCTCCGGCGGCACCAAGGTGACCTCGGATCGGTAGGATACCCGCTGAACTTAAGCATAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||