Barcode Identifiers

Sequence ID: WSF172-09
Sample ID: FWL1IIIE4
Identified As:
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 589
GTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTTCGGAAGGATCATTACCGTAACGCGGCGGTCCGGCAACCGCAAGGAAGCGGCCGCCACACGCGTTTATCACCCTTGACTTTGAGCACCTTTCGTTTCCTCGGCGGGTTCGCCCGCCAGCGAGGACCCCCACAAACCCTTTGTAATAGCAATATTCGTCTGAAAACAACCAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTAACCCCTCAAGCCTAGCTTGGTATTGGGTGCTTGTCCCGCCTCTCGCGCGGCGACTCACCTCAAAGTCATTGGCAGCCCGCATCTCGCCGGCCGTGAGCGCAGCACAGACGCGCTCTTGGCAACGACGGATCGGCTCTCCAAAAGCTTATTCAACCACTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAGGCGGAGGCTACA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||