Barcode Identifiers

Sequence ID: WSF171-09
Sample ID: FWL1IIID12
Identified As: Mortierella sp.
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 626
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCACAACGAGTGTTTTATGGCACTCTTTAAAAATCCTATCCACCTTGGTGCAATGTTTGTTGGGAAAGTCTTTTCTTTCCCTTCATAAATATCAACCTATATCTTTAACAACATTCGTCTGATAACATATTATGAATATACTTAATTCAAAATATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCCGAAGAGCATGCTTGTTTGAGTATCAGTAAACACCTCAACCTCTCTTTTTTGATAAAAAAAAGGGAGGGTGGACTTGAGCTATCCCAACGACCTTCACCGGTAGGCGGGCGGCTTGAAATGCAGGTGCAGCTGGACTTTTATCTGAGCTAAAAGCATATCTATTTAGTCCTCGTCAAACAGGATTATTACTTTTGCTGCAGCTAACATAAAGGATAATTGTCCTCTTGCTGACTGATGCAGGATTTTACGACACTTTATGTGTTGTTCAACTCGTCTCAAATCAAGTAGACTACCCGCTGA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||