Barcode Identifiers

Sequence ID: WSF158-09
Sample ID: FWL1IIH9
Identified As: Acremonium sp.
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 529
GTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTATTGTTGCTTCGGCGGGATCGCCCCGGCGCCCTCGGGCCCGGACCCAGGCGCCCGCCGGAGGACCCAAACTCTTGTCTTTCATGAGTATCTTCTGAGTAACATAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGCTTGGTGTTGGGGATCGGCCGCCCTCTCCGGCGCGCCGGCCCCGAAATCTGTGGCGGTCTCGCTGTAGCCTCCTCTGCTAGTAGCACACCTCGCACCGAACGCAGCCTGGCCACGCCGTTAACCCCCCACTTCTAAGGTTGACCTCGGATCAGGTAG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||