Barcode Identifiers

Sequence ID: WSF128-09
Sample ID: FWL1IIA9
Identified As: Acremonium cyanophagus
Last Updated
Marker ITS

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser. Sorry!

Sequencing Runs (Reverse)

If you see this text, it means that you are not using a java capable browser. Sorry!

Nucleotide Sequence

Residues: 575
TCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACTGAGTGTAAAAACTCCCAAACCCCTGTGAACATACCATCCGTTGCTTCGGCGGGATCGCCCCGGGCGCCTTTGCGTGCCCCGGATCCAGGCGCCCGCCGGAGGACTCCAAACTCTTGTTTTATATGTGGCATTATCTGAGTGGCTTATAGCAAAATAAATCAAAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGAGCGTCAGTTCAACCCTCGCAACCGGCTTTGCTGGATGTGGTGTTGGGGATCGGCTGCCTTCTAGGTGGCCGGCCCCGAAATAGAGTGGCGGTCTCGTCGTGGCCTCCTCTGCGTAGTAGCAATATCTCGCAGGCGGAGAGCGGCGTGGCTATGCCGTAAAACACCCAACTCTTCTAAGGTGACCTCAGATCAGGTAGATACCCGCTGAACTTAAGCATAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||