Barcode Identifiers

Sequence ID: WSF075-09
Sample ID: 2WL1IIIA5
Identified As:
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 669
TACAAGGTTTCSGTAGGTGAACCTGCGGAGACATTATCATGCAAGTTTCTCCAATGAATTTTGGGGTTCTTTGATAAAATTTCTCTTCTTTTTCCTTTCTTTGAGGGAATTGAAGGAATCCACTGTGATCTGTTTCGAGCTTTTTTTCATTTGAAAAAGCTACAACCCGTTTTTTTTCTTTGGGAAACAAACGGGTGTGGGGCCTTTTTAGGTCTCGCAATTCAATATACTTTATGAAATTCTTGATTGATTCTTAATTGAAACAAAAAAACAACTTTCAACAATGGATCTCTCGGCTTACGCATCGATGAAGAACGCAGCGAATCGCGATATGTAATGTGATCTGCATTTAGTGAATCATCGAATCTTTGAACGCATCTTGCGCCCAAGGGTAATCCTTTGGGCACGCCTGTTTCAGTGTTATGTTAAACCCAAAATCTCTTTTTTTGGTGATGTAACGTTGGGCTTGCCAATCATTTTTTTGATCGGTCTTGCTTGGAATGATATCAATTCCAGTCGGATCACCTTATTCTTCAGATCAGGCTTTGGTAGACTACCGAAAGTCGCGTTTGAACGGATTTAGGCCCGAATTGATGGGATTTTTAAAACATTTTCAATATTAACCTGAAATCAGGCGGGACTACCCCGCTGAACTTAAGCATATCATAA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||