Barcode Identifiers

Sequence ID: WSF071-09
Sample ID: 2WL1IIH4C
Identified As: Acremonium sp.
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 541
TACACRGTCTCCGTTGGTGAACCAGCGGAGGTCATTACTGAGTGTTACACTCCCAAACCCTTTGTGAACACTACCATTCGTTGCTCGGCGGGACCGCCCCGGCGCCTCTGCGCGCCGGAACCAGGCGCCCGCCGGGGGCCCGAAACTCTTGTTTTGTCAGTGGTATTTTCTCTGAGTGGCATAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGGGCCCCGCATTCGTGCGGGCCCCGGCGTTGGGGACCGGCCTCCGCATCGGACGGCCGCCCCGAAACCCAGTGGCGGTCCCGCCGCGGCCTTCTCTGCGTAGTAGCATACACCTCGCACTGGAGAGCGGCGCGCCACGCCGTAAAAGAACGAACTTTCTGAAGGTGACCTCGATCAGTA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||