Barcode Identifiers

Sequence ID: WSF029-09
Sample ID: 2WL1IG5
Identified As: Mortierella sp.
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 646
ATCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAGGACATTCATAATAAGTGTTTTATGGCACTTTTTAAATCCATATCCACCTTGTGTGCAATGTCGGTCGATCTTCTTCATGGAGATCGACCAAACATCAACCTTTATCTTTTAACTCTTTGTCTGAAAAATATTATGAATAAACAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCCGAAGAGCATGCTTGTTTGAGTATCAGTAAACACCTCAAAGCTTTTGGATTTTTTAATCGAAAAGCTTTGGACTTGAGCAATCCCAACACCAATCTTTTTGAGATCGGTGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTCCTGAGCTAAAAGCATATTCATTTAGTCCCGTCAAACGGATTATTACTTTTGCTGCAGCTAACATAAAGGGAGTTTGACCGTATTGGCTGACTGATGCAGGATTTCACAAGGGTCGGCAACGATTCTTGTTAAACTCGACTCAAATCAAGTAAGACTACCCGCTGAACTTAAGCATATCATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||