Barcode Identifiers

Sequence ID: WSF016-09
Sample ID: 2WL1IC11
Identified As:
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 672
TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCAATGCAAAGTTTCTCCAATGAATTTTGGGGTTTCTTTGATAAAATTTCTCTTCTTTTTCCTTTCTTTGAGGGAATTGAAGGAATCCACTGTGATCTGTTTCGAGCTTTTTTTCATTTGAAAAAGCTACAACCCGTTTTTTTTCTTTGGGAAACAAACGGGTGTGGGGCCTTTTTAGGTCTCGCAATTCAATATACTTTATGAAATTCTTGATTGATTCTTAATTGAAACAAAAAAACAACTTTCAACAATGGATCTCTCGGCTTACGCATCGATGAAGAACGCAGCGAATCGCGATATGTAATGTGATCTGCATTTAGTGAATCATCGAATCTTTGAACGCATCTTGCGCCCAAGGGTAATCCTTTGGGCACGCCTGTTTCAGTGTTATGTTAAACCCAAAATCTCTTTTTTTGGTGATGTAACGTTGGGCTTGCCAATCATTTTTTTGATCGGTCTTGCTTGGAATGATATCAATTCCAGTCGGATCACCTTATTCTTCAGATCAGGCTTTGGTAGACTACCGAAAGTCGCGTTTGAACGGATTTAGGCCCGAATTGATGGGATTTTTAAAACATTTTCAATATTAACCTGAAATCAGGCGGACTACCCGCTGAACTTAAGCATAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||