Barcode Identifiers

Sequence ID: TSA375-10
Sample ID: Abbott9150
Identified As:
Last Updated
Marker rbcLa

Nucleotide Sequence

Residues: 555
TTTGTT---GGATTCAAAGCTGGTGTTAAAGATTATAAGCTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCGGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGGCTTACCAGCCTTGATCGTTATAAAGGAAGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATATGTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGGAATGTATTTGGCTTCAAAGCCCTTCGAGCTATACGTCTGGAGGATTTGCGAATCCCTACTGCCTATGTTAAAACTTTCCAAGGACCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTAGGATGTACTATTAAACCGAAATTAGGTTTATCCGCTAAGAATTACGGTAGAGCGGTTTATGAATGTCTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||