Barcode Identifiers

Sequence ID: TRENT003-10
Sample ID: FJ534598.1
Identified As: Cephaleuros virescens
Last Updated
Marker rbcL

Nucleotide Sequence

Residues: 876
GACCGTTACAAAGGACGTTGTTATGATATTGAAGCAATTCCAGGAGAGGATGATTCTTTCTTTGCTTATGTAGCTTATCCAATTGATTTATTCGAAGAAGGATCGGTAACTAACTTATTAACATCAGTTGTAGGAAACGTATTTGGATTCAAAGCATTACGTGCTCTACGTCTTGAAGATTTACGTATTTCTAAAGCTTACATTAAAACTTTCTTTGGTCCTCCACACGGAATTCAAGTTGAACGTGATAAATTAAACAAATACGGTCGTGCTTTCCTTGGATGTACTATTAAGCCTAAATTAGGATTAAGTGCTAAAAACTACGGACGTGCTTGCTATGAGTGTCTACGCGGAGGATTAGATTTCACAAAAGATGATGAAAACGTAAACTCACAACCATTCATGCGTTGGCGTGACCGTTTTGCATTTGTAGCGGAAGGAATTTACAAATCACAAGCGGAAACTGGGGAAATTAAAGGACACTACCTAAACGCTACAGCTCCAACTTCAGAAGAAATGTTATTCCGTGCACAAACGGCAAAAGATTTTGGAGTACCTATTATCATGCACGACTATTTAACGGGAGGGTACACAGCTAATACTTCTTTAGCTAACTATGCTCGTAACCATGGTTTATTACTACACATTCACCGTGCAATGCATGCAGTAATTGACCGTCAACGTAACCACGGAATACACTTCCGTGTTCTAGCTAAAACTCTACGTATGTCTGGAGGAGACCATTTACACTCTGGTACAGTAGTAGGAAAACTAGAAGGGGACCGTGATATTACCCAAGGGTTCGTCGATCTCATGAGAGACGATACAATCGAGCGTGACCGCCATCGTGGAGTATTCTTCCATCAAGAGGGGATG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||