Barcode Identifiers

Sequence ID: TRENT001-10
Sample ID: FJ534596.1
Identified As: Cephaleuros parasiticus
Last Updated
Marker rbcL

Nucleotide Sequence

Residues: 879
GATCGTTACAAAGGGCGTTGTTATGACATTGAGGCGATTCCAGGGGAAGATGATAGTTTCTTTGCTTACGTTGCTTATCCTATTGATTTATTTGAAGAAGGGTCGGTAACAAACTTATTAACATCGGTAGTAGGAAACGTATTTGGATTTAAAGCATTACGAGCACTTCGTTTAGAAGATTTACGTATCTCTAAAGCTTACATTAAAACGTTCTTTGGACCACCACACGGAATTCAAGTTGAGCGTGATAAATTAAACAAATACGGTCGTGCCTTTTTAGGATGTACCATTAAACCAAAACTAGGATTATCAGCTAAAAACTACGGACGTGCTTGTTATGAGTGTTTACGAGGGGGTCTTGACTTCACTAAAGATGATGAAAACGTAAACTCACAGCCATTCATGCGCTGGCGTGACCGTTTTGCATTTGTAGCAGAAGGAATTTACAAAGCACAAGCTGAAACAGGGGAAATTAAAGGTCACTACTTAAATGCAACCGCACCAACTTCAGAAGAAATGTTATTCCGTGCACAAACTGCAAAAGATTTTGGAGCACCTATTATTATGCACGACTATTTAACTGGAGGTTACACAGCAAACACTTCATTATCAAACTATGCTCGTAATCACGGATTACTTTTACACATTCACCGTGCAATGCACGCAGTAATTGACCGTCAACGTAACCACGGAATTCACTTCCGAGTTTTAGCTAAAACATTACGTATGAGTGGAGGAGACCACTTACACTCTGGAACAGTTGTAGGTAAATTAGAAGGAGACCGTGACATTACTCAAGGGTTTGTCGACCTAATGCGCGACGATTACATAGAAAAAGACCGTCACCGCGGAGTATTCTTCTCACAAGAATGGATGGGA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||