Barcode Identifiers

Sequence ID: TREMA160-07
Sample ID: Alar Rapi 4
Identified As: Alaria mustelae
Last Updated
Marker 18S

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser. Sorry!

Sequencing Runs (Reverse)

If you see this text, it means that you are not using a java capable browser. Sorry!

Nucleotide Sequence

Residues: 347
CCTTAAACGGTGAAACCGCGAATGGCTCATTAAATCAGCTATGGTTCCTTAGATCGTACATGCTACATGGATAACTGTAGTAATTCTAGAGCTAATACATGCCACTATGCCCTGACCCGCAAGGGAACGGGTGGATTTATTAGAACAGAACCAACCGGGAACGGCTTCGGTCGTTCCTGTTGCACTCTGTGATGACTCTGGATAACTTTACTGATCGCAGTCGGCCTTGTGTCGGCGACGGATCTTTCAAATGTCTGCCCTATCAACTTTCGATGGTAGGTGATCTGCCTACCATGGTGATAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||