Barcode Identifiers

Sequence ID: TABAR016-09
Sample ID: FJ176212
Identified As: Macrobiotus macrocalix
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 741
TATGAGCTGCTTGTGTAGGAACTTCACTCAGCTTTATTATCCGAAGAGAACTAAGACAACCTGGCATCTTATTTGGAGATGAACAAATATATAATGTTACTGTTACTAGCCACGCTTTTATTATAATTTTCTTTTTTGTAATACCTATTCTAATTGGGGGATTTGGAAACTGACTTGTACCCTTAATAATTGGTGCCCCTGATATGGCATTCCCCCGAATAAACAATCTTAGATTTTGATTATTACCACCATCTTTCACACTTATTATAACTAGAACAATAAGAGAACAAGGAGCAGGAACAGGATGAACAGTATACCCCCCCTTATCTCATTTTTTTGCCCATAGAGGTCCCAGAGTAGACTTAACTATTTTTTCTCTGCATATTGCAGGTATTTCTTCAATCTTAGGAGCCATTAATTTTATTTCTACAATTTTAAATATACGAACTCCTAGAATAACTTTAGAAAATATACCTCTTTTTGTATGGTCCGTTCTTATTACTGCTATTCTTTTGTTATTAGCCCTACCTGTATTAGCCGGAGGTATTACAATACTATTAATAGACCGAAATTTTAACACTTCTTTCTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATACCAACATCTCTTTTGATTCTTTGGGCATCCTGAAGTATACATTTTGATTTTACCAGGATTTGGAATTATTTCTCAAATCGTAATTCATTTTAGAGGAAAACATTTAACCTTTGGACATT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||