Barcode Identifiers

Sequence ID: PLON041-07
Sample ID: AP328
Identified As: Pinus strobus
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 655
GGATATAGGGACTCCACATTCAATCTTCGGTGCCATTGCTGGAGTAATGGGCACATGCTTCTCAGTACCAATTCGTATGGAATTAGCACAACCCGGCGATCAAATTCTTGGTGGGAATCATCAACCTCATAATGTGTCAATAACGGCTCACGCTTCTCCAATGATCCCTTTTATGGTTATGCCGGCGGTGATAGGTGGATCTGGTAATTGGTCCGTTCCGATTCCTATAGGTGCACCTGACATGGCATTTCCACGATTGAATAATATTCCATCCCGGTTGTTGCCACCTTCGCTGTTGCTCCCATTAAGCCCAGCCTCGGTAGAAGTGGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCCTAAGTGGTATTACCAGTCATTCCGGAGGAGCTGCTGATCCAGCGATTTCTAGTCCTCATCTATCAGGTGTTTCATCCATTTCAGGTTCTATCAATCTCATAACTACTATCCCCAACATGCGCGGGCCTGGAATGACTATGCATAGATCACCCCTATTTGTGCGGTCCGTTCCAGTGACAGCATTCCTACTCTTATCATCACTTCCGGTACCGGCAGGGGCAATTACCATGTTATCAACTGATCGAAGCTTTAATACAACCTTTTTCGATCCTGCTGGAGGGGGAGACCCGATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||