Barcode Identifiers

Sequence ID: NNOP076-08
Sample ID: HLC-26783
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 407
TAAGTTTCTGACTCCTGCCCCCGGCTCTATTACTCCTCCTATTATCTGGTATGGTGGAAAGAGGGGTAGGGACTGGATGAACGGTATATCCTCCTCTGAGT---ACTGTCGGTCATTCTGGAGGTGCTGTCGACTTGGGTATCTTTTCCTTACATTTAGCTGGTGTTAGGAGCATTTTAGGCAGAGCCAATTTTATCACTACCATTGCTAATATAAAAGGCGAAGGTATAACTATAGAACTTATGCCTCTTTTTGTTTGGGCTGTCTTATTAACAGCTATCCTTTTATTACTTTCTCTACCAGTGCTAGCCGGTGCTATCACTATATTGTTGACTGACCGCAATTTTAACACTTCTTTCTTTGATCCTGCGGGAGGTGGTGATCCTATTCTATATCAGCATCTTTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||