Barcode Identifiers

Sequence ID: NNMX218-08
Sample ID: HLC-25774
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 613
CTTAGTTGGGACTGCTTTGAGTTTGTTAATTCGGGCTGAATTAGGGCAACCTGGAGCATTATTAGGTGATGATCAACTATATAATGTAATTGTCACTGCTCATGCTTTTGTAATAATTTTTTTTTTAGTAATACCGATGATGATTGGAGGGTTTGGAAATTGGTTAGTTCCGTTAATATTGGGGGCGCCTGATATGGCTTTCCCTCGACTAAATAATATGAGATTTTGGCTGCTGCCCCCCTCTTTGTGTTTACTTTTAGCCTCTGCTGCAGTAGAGAGGGGGGCAGGTACTGGGTGGACGGTTTACCCTCCTTTAGCAAGAAATATTGCTCATGCTGGGGGTTCAGTTGATTTGGCTATTTTTTCTTTACATTTAGCTGGGGTGTCTTCTATTTTAGGGGCAGTAAATTTTATTACAACAGTTTTAAATATGCGCTGGGAGGGGATACAGTTAGAGCGGTTACCATTATTTGTGTGATCTGTAAAAATTACAGCTATTTTATTATTACTATCTTTACCTGTTTTAGCGGGAGGAATTACTATATTATTAACTGATCGTAATTTTAATACAGCTTTTTTTGATCCTGCGGGTGGGGGAGACCCTATTTTATAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||