Barcode Identifiers

Sequence ID: MACRO462-07
Sample ID: GWS005180
Identified As: Agarum clathratum
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 658
ATTATATTTAATATTTGGTGGTTTCTCAGGGGTTCTTGGAACAGCAATGTCTGTGCTTATTCGTTTACAACTAGCTAGTCCTGGAAATCAATTTTTGGGAGGAAATCATCAGTTGTATAATGTTATTGTAACCGCCCATGCCTTTTTAATGATTTTTTTTATGGTTATGCCAATTCTTATTGGTGGGTTTGGTAATTGGTTTGTCCCTTTAATGATTGGTGCGCCTGATATGGCTTTTCCCCGTATGAACAACATTAGTTTTTGGTTGTTGCCCCCGTCTTTAATTCTTCTTTTAGCCTCTTCTTTGGTAGAATCTGGTGCTGGTACAGGATGGACGGTGTACCCACCGCTTAGTGGTATTCAAGCACACTCAGGTCCTTCTGTTGATTTAGCAATATTTAGTCTTCACCTTTCAGGTGCTGCTTCTATTTTGGGGGCTATAAACTTTATTACAACAATTTTTAATATGAGAGCACCTGGTATGACTATGGATAGGTTACCTCTTTTTGTATGGTCTGTCTTAATTACAGCGTTCTTGTTATTATTATCACTTCCTGTATTAGCTGGTGCTGTTACAATGTTGTTAACAGATCGTAATTTCAATACTACCTTTTTTGACCCTGCTGGTGGTGGTGATCCAGTATTATATCAACATTTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||