Barcode Identifiers

Sequence ID: LIPOL017-08
Sample ID: Lizard017
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 346
TCTGCTTTCCTAGGAACTGCTTTGTCAGCGCTAATCCGCCTAGAGTTAGGAGCGCCAGGCTCCCTACTTGGAGACGACCAGCTTTACAATGTAATTGTGACTGCTCACGCCTTTATTATAATCTTTTTTTTTGTAATACCCACTATAATAGGAGGGTTTGGTAATTGACTGGTTCCTCTAATGGTTAACGCCCCCGATATGGCATTCCCCCGAATAAATAATATAAGATTTTGACTGCTGCCTCCGGCTCTGTCAATACTTTTAATGTCAGGGCTGGTAGAGAGCGGAGTTGGAACCGGATGAACGGTTTACCCTCCGCTGTCGACAATAGGGCACCCTGGCAGAG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||