Barcode Identifiers

Sequence ID: LIMC330-08
Sample ID: HLC-25470
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 380
TCTCTTACTTTGATAGTTGGTAGAATATTTTGTGGAGAAGGTGCAGGAACAGGGTGAACAGTTTATCCTCCTCTATCTGCAAGTTTATTTCATTCAACTATTTCTGTAGATATAGCTATTGTTAGCTTACATATTGCTGGTGTTTCTTCAATTTTAGGTGCAATTAATTTTATTTCTACAATTCGTCATTATAGAATT------ATAAAAATATTTCATATACCATTATTTGTATGGTCTGTCTTAATTACAGCTATTTTATTGCTCGTATCACTACCTGTATTAGCGGGAGCTCTAACTATATTACTAACAGACCGAAATTTAAATACTTCTTTTTTCGATCCTACCGGTGGTGGAGATCCGATTCTTTATCAACATCT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||