Barcode Identifiers

Sequence ID: KSR519-08
Sample ID: AP326-b
Identified As: Lycopodium digitatum
Last Updated
Marker rbcLa

Nucleotide Sequence

Residues: 607
AAGTGTTGGATTCAAAGCTGGCGTTAGGGATTACAGATTAACTCATTACACTCCTGATTATAAGACCAAAGAAACCGATATTCTGGCAGCATTTCGAATGACTCCTCAACTTGGAGTACCACCCGAGGAAGCGGGAGCCGCAGTAGCTGCTGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGTCTCGATCGCTACAAAGGTCGGTGCTATGAAATTGAACCTGTTGCTGGAGAAAAAAATCAATATATTGCTTATGTAGCTTATCCTCTGGATCTGTTTGAGGAAGGTTCCGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGAGCTTTACGTTTAGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCATGGGTCCGCCCCATGGTATCCAAGTCGAAAGAGACAAATTGAACAAATATGGCCGTCCTTTATTAGGATGTACTATTAAACCAAAATTAGGTTTATCCGCTAAAAACTATGGTAGAGCTGTTTATGAATGTCTTCGTGGTGGACTTGATTTCACTAAGGATGATGAAAACGTGAATTCTCAACCGTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||