Barcode Identifiers

Sequence ID: KSR515-08
Sample ID: AP097-b
Identified As: Dryopteris carthusiana
Last Updated
Marker rbcLa

Nucleotide Sequence

Residues: 583
AGGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTATTACACCCCCGAATACAAGACTAAAGATACCGATATCTTAGCAGCCTTTAGAATGACCCCGCAACCTGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTCGACCGTTACAAAGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCTATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAANNNCTCCGCGGCGGACTTGATTTCACGAAAGATGAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||