Barcode Identifiers

Sequence ID: KSR235-07
Sample ID: AP321
Identified As: Athyrium filix-femina
Last Updated
Marker atpF-atpH

Nucleotide Sequence

Residues: 399
TTAAGTTAATTAAGTTTATCTCCAAGATATTGGTATTTAAGCCAATACTTGCGGC---AAGAGTCCAATCACTTGAGGGAGCAACGATCTCACTTACACTTCTCGTAATCCTTTCCCTCCTGGAAGGTTTTGCAAGATTTAAACAACTTCTGGTCCGGCCTGGGGGGAGGTGACAAATTCCGAATTTCGAAAAATCAAGAGAAAATCGGGATGGGGACAAGATTTTCCGAGTCATTAATTTTGGCGACTTATATTGGTTTACCCGATTCGTCAAAACTTTCTAGTTTGGTGGAGAGAGGGGGAGTTACAACTAGACGCGGCAGGTACTCGGTTGGGTAGGCGGAACAGCAACTTCCTACCAAGCCCCTCCCTCCCGGCTCACCACTGATTCGAAAACAG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||