Barcode Identifiers

Sequence ID: KSR214-07
Sample ID: AP289
Identified As: Adiantum pedatum
Last Updated
Marker rbcLa

Nucleotide Sequence

Residues: 599
AGGTGTTGGATTCAAAGCTGGTGTCAAAGATTACCGATTGACCTATTACACTCCCGAATACAAGACCAAAGACACTGATATCTTAGCGGCTTTCCGAATGACTCCACAACCTGGAGTACCGGCTGAGGAAGCCGGAGCTGCAGTAGCTGCGGAATCTTCCACTGGTACGTGGACCACGGTATGGACAGACGGACTTACTAGTCTTGATCGGTATAAGGGCCGGTGCTACGATATCGAGCCCGTAGCTGGGGAGGAGAATCAGTATATCGCATATGTAGCTTATCCTCTGGATTTATTCGAGGAAGGTTCCGTCACTAATATGCTGACTTCTATTGTAGGTAATGTTTTTGGATTTAAGGCTCTACGCGCTCTGCGTCTGGAAGACTTACGAATTCCACCTGCTTATTCCAAAACTTTCATGGGACCCCCTCATGGGATTCAGGTGGAGAGGGATAAACTAAACAAATATGGACGTCCCCTATTGGGATGTACAATCAAGCCAAAATTGGGCTTGTCTGCCAAGAATTATGGTAGAGCAGTTTATGAATGCCTCCGTGGTGGACTTGATTTCACAAAAGATGATGAAAACGTCAATTCCC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||