Barcode Identifiers

Sequence ID: KSR213-07
Sample ID: AP286
Identified As: Matteuccia struthiopteris
Last Updated
Marker rbcLa

Nucleotide Sequence

Residues: 591
AGGTGTTGGATTCAAAGCTGGTGTCAAAGATTACCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGGGTACCTGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCTATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCTCTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGGTGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTTACAAAAGATGATGAAAACGT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||