Barcode Identifiers

Sequence ID: KSR108-07
Sample ID: AP144
Identified As: Botrychium virginianum
Last Updated
Marker atpF-atpH

Nucleotide Sequence

Residues: 510
AAGATAGATTAATACACCCATTACTACACCCAAATTAATTAGATTTATCTCTGAAATATTGGTATTTAATCCAAAACCTCCTGC---AAGAGGCCAATAACTCGGGAAAGTAATAGAATCAGTCACATTTTTCATAAGCTCTCTCCCATAATGGGCTATCTAAATCTGATAGAGTCTCTTCTTCATGGAATCCTATCCAGAGTTATGCGTTTGAATGGAGAATCCATTAGTATTCAGTAAAATTTATCTAGGAATAGGATTGGACGAACGATTCGTTCGCTCCACCCCCTGGCGTGGGAGTCAATAATATTACCACCCAAATGGAGGGATAGGATTGGTACTTACCCGGTATTATTAGCCCCTCCCCGGAAGGATGAATAATTGGACGAATGATTAGAGGAGGGTTTTCTCAATATGGGGGCACAATAGAGCTTTCAATGTGTTTTAAACCACGCTGATTAAACGAAAGGATTTGCAAATAGAAGTGCTGGGGCTACGACTAACCCATAG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||