Barcode Identifiers

Sequence ID: HY036-07
Sample ID: DAOM 2266670.1
Identified As: Acremonium cf. chrysogenum
Last Updated
Marker COI-5P

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser. Sorry!

Sequencing Runs (Reverse)

If you see this text, it means that you are not using a java capable browser. Sorry!

Nucleotide Sequence

Residues: 567
TATTTCAAATAATCAATTATATAACAGTATTATTACAGCTCACGCTATTTTAATGATATTCTTCATGGTTATGCCTGCATTAATTGGAGGATTTGGTAATTTCTTAATGCCTTTAATGGTAGGTGGACCTGATATGGCCTTCCCTAGATTAAATAATATTAGTTTCTGATTATTACCACCTAGTTTACTTTTATTAGTATTCTCTGCTGTTATTGAAGGTGGAGTAGGTACAGGTTGAACACTTTATCCTCCGTTAGCTGGATTACAAAGTCATAGTGGACCAAGTGTAGATCTTGCAATTTTTGCTTTACATTTATCAGGGGTAAGTAGTTTATTAGGAGCAATTAATTTTATTACTACTATTGCTAATATGAGAACACCAGGTATTAAATTACATAAACTAGCTCTATTTGGATGAGCTGTAGTTATAACAGCTATATTACTTTTATTATCATTACCTGTATTAGCTGGAGGTATAACTATGGTTTTAACCGATAGAAATTTCAATACATCATTCTTTGAAGTAGCTGGAGGTGGAGACCCTATATTATTCCAACATTTATTCTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||