Barcode Identifiers

Sequence ID: HERB034-11
Sample ID: EDNA09-02156
Identified As: Herbertus norenus
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 557
GCTTGAGGAACGTGAAGTCAGAGACTGAGCCTGGGGTCCTAGTCTTGCTCTCACGGGTGAGAGTTCGGGGCCCCGAGTCGAAAACCAAAACAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTTGTCCCGAGGGCATGCCTGCCTGAGCGTCACCGCACTCCCACTCCCGTGGTTACATCTCGGTTCGAGGACCGGGGG---TGCTGCCGAGAGTGGAACTGGCCGTCCGGGACCCGGCGTGAAGCCGATG--GTCGTGGTTGGCTGAAATGCAGCGTTCTGGACGCAGCTTAAGAGAGGAGCCGCGAGAAGGTGATCCGCCCCTCGCCGGGCGGAGTCAAAAGACAGCGGTTCTCTCGCTTGGGTGGTCCGGGACGACCGCGGCGGGGCACAGCCCCGTCGGGGAAA--TGCGAGGGGATGGCCTGTCCATCTCCCTCTCCAGCTTGGACCTCAGATCAGG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||