Barcode Identifiers

Sequence ID: HERB008-11
Sample ID: EDNA09-01004
Identified As: Herbertus hutchinsiae
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 712
CCTCCGG-GAGTGAGTTGTT----GGCGGTCGAGGTCGGGCCCTCCCCTCCCCCCTCTGTCCCTGTCTTTGGGGACTCGGGGGCCGATTTTTCCACAAGCAGCTTGAGGAACGTGAATTCAGAGACTGAGCATGGGGTCCTAGTCTTGCTCTCATGGGTGAGAGTTCGGGGCCCCGAGTTGAAAACCAAAACAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTTGTCCCGAGGGCATGCCTGCCTGAGCGTCACCGCACTCCCACTCCCGTGGTTACATCTCGGTTTGCGGACCGGGGG---TGCTACCGAGAGTGGAACTGGCCGTCCGGGACCCGGCGTGAAGCCGATG--GTCGCGGTTGGCTGAAATGCAGTGTTCTGGACGCAGCTTAAGAGAGGGGCCGCGAGAAGGTGATCCGCCCCTCGCCGGGCGGAGTCAAAAGACAGCGGTTCTCTCGCTTGGGTGGTCCGGGATGACCGCGGCGGGGCACGGCTCCGTTGGGGAAA--TGCGAGGAGATGGCTTGTCCATCTCC-TCTCCAGCTTGGACCTCAGATCAGGCAAGATTACCCGCTGAGTTTAAGCATATCACTAAGCGGAGGAAAAGAAACTAAC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||