Barcode Identifiers

Sequence ID: HAPT051-08
Sample ID: CCMP288
Identified As: Chrysochromulina camella
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 620
GTATTAAAGTTACGGTCGGTTAATAACATTGTAATAGCACCGGCTAGTACAGGTAATGATAACAATAATAAAAAAGCTGTGATATAAACAGCTCACACAAATAACGGTGTTCGGTGTGCTGTCATACCTGGTGCTCGCATGTTTGTTATGGTAACAATAAAGTTAATAGCACCTAAGATTGAAGAGACACCAGCTAAATGCAAAGAATAAATAGCACAATCAACAGATGCTCCAGAGTGGGCTTGAATACCTGATAAAGGTGGGTAAACAGTTCAACCTGAACCAACACCAGCTTCAACTAAAGAAGATGAAATTAATAATAGCAATGATGGTGGTAGTAATCAAAAGCTAATATTATTTAAACGCGGAAATGACATATCACAAGCACCAATTAAAATAGGCACAAATCAATTACCAAAACCACCGATAGCCGTTGGCATTACGAAAAAAAAAATCATCAAAAAAGCGTGTGATGTGATTAACACGTTATATAATTGATAATTACCGGATAAAAAAGCGTCACCTGCTTGACTTAGTTCTAAACGCATAAACATTGAAACTACAAAACCTAGAATACCTGAAAAGGCACCGAAGATAAAATATAACGTTCCAATATCTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||