Barcode Identifiers

Sequence ID: HAPT025-07
Sample ID: CCAP944/2
Identified As: Hymenomonas pringsheimii
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 693
AAAGATATTGGTTCTTTATATTTTATTTTTGGTGCCTTTTCTGGCGTACTTGGCTTCGCGATTTCGTTAATAATGCGTTTAGAACTTTCGCAAGCTGGTGATGCTTTTTTAAGCAATAACTTCCAAGTCTATAATGTTCTTGTTACTTCGCACGCAATAGTTATGATTTTCTTTTTTGTAATGCCAACAGCTATTGGTGGTTTCGGAAACTGGTTTGTTCCAATACTAATCGGAGCTTGTGACATGGCTTTTCCTCGACTAAACAATATTAGTTTACTTCTTTTGTTTCCTGCTGTAATTCTCTTATTATCTTCTTCTTTAATCGAAGCCGGTGTTGGTACTGGTTGAACAGTTTATCCTCCATTATCTGGTATACAAGCTCACTCTGGAGGTTCTGTTGACGTTGCAATTTTCTCTTTACACTTAGCTGGTGTTTCTTCTATACTTGGTGCTATAAATTTTATTGTCACAATTTCTAACATGCGAGCTCCTGGAATGTTTGCTCATAGAACGCCACTTTTTGTCTGAGCTGTTTTTATAACTGCCTTCTTACTATTGCTTTCTCTTCCTGTTCTTGGTGGTTGTATTACAATGTTATTATCTGATAGAAATTTTAATACATCTTTTTTTGACGCAGCTGGAGGTGGTGATGTTCTCTTATTTCAACACTTATTTTGATTTTTTGGTCACCCG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||