Barcode Identifiers

Sequence ID: GWOR3927-09
Sample ID: BC ZSM Lep 21211
Identified As: Abrostola tripartita
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 658
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCCCCCTCTTTAACCTTGTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATGGAGGTAGATCTGTAGACTTAGCTATTTTTTCTTTACATTTAGCCGGAATCTCCTCAATTCTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAACATTTTTACTTTTACTTTCATTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGTAATCTAAATACTTCATTTTTTGATCCAGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||