Barcode Identifiers

Sequence ID: GRASS935-07
Sample ID: 06-JMS-0746
Identified As: Agrostis capillaris
Last Updated
Marker matK

Nucleotide Sequence

Residues: 825
TTAGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCAACTACTAT------TCAAATTGGAATAGTTTTATTACTTCAATGAAATCTATTTTTCTTTTTAAAAAAGAAAATAAAAGACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTATCATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAGGAAGATGGAACATTTTGGGATAATGTACCCGGTTTTTTTTCGGAAAACCATATGGTTCTTTATGGATCCTATGATGCATTATGTTCGCTATCAAGGAAAGGCAATTCTTGGATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGTACCTTATCAATTTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAACCAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTGTACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAGATACTCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGGCACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACANACTTTGTATCGCCNAAAGTATATACNT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||