Barcode Identifiers

Sequence ID: GRASS1169-07
Sample ID: 07-JMS-1159
Identified As: Agrostis aequivalis
Last Updated
Marker matK

Nucleotide Sequence

Residues: 822
TTAGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCAACTACTAT------TCAAATTGGAATAGTTTTATTACTTCAATGAAATCTATTTTTCTTTTTAAAAAAGAAAATAAAAGACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTATCATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAGGAAGATGGAACATTTTGGGATAATGTACCCGGTTTTTTTTCGGAAAACCATATGGTTCTTTATGGATCCTCTGATGCATTATGTTCGATATCAAGGAAAGGCAATTCTTGCATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGTACCTTATCAATTTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAACCAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTGTACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAGATACTCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGGTACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACAGACTTTGTATCGACTAAAGTATATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||