Barcode Identifiers

Sequence ID: GRASS1143-07
Sample ID: 07-JMS-1114
Identified As: Agrostis oregonensis
Last Updated
Marker matK

Nucleotide Sequence

Residues: 594
TTAGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCAACTACTAT------TCAAATTGGAATAGTTTTATTACTTCAATGAAATCTATTTTTCTTTTTAAAAAAGAAAATAAAAGACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTATCATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAGGAAGATGGAACATTTTGGGATAATGTACCCGGTTTTTTTTCGGAAAACCATATGGTTCTTTATGGATCCTATGATGCATTATGTTCGCTATCAAGGAAAGGCAATTCTTGGATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGTACCTTATCAATTTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAACCAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTGTACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||