Barcode Identifiers

Sequence ID: GBSP1302-06
Sample ID: DQ832701
Identified As: Xenoturbella bocki
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 901
AACCGTTGATTATTTTCAACCAATCATAAAGATATCGGCACGTTATACATTTTCTTCGGAATCTGAGCCGCAATAGTAGGCACAGGATTAAGCATAATCATTCGACTAGAGTTAACACAACCTGGAGCACTATTAGGAGAC---GATCAAATTTACAATGTTGTAGTCACAGCACACGCCTTAGTGATAATTTTTTTTATAGCTATACCCATTATAATTGGGGGGTTTGGAAATTGACTTCTACCGTTAATAATTGGAGCCCCAGACATAGCTTTTCCACGTTTAAACAATATAAGCTTCTGACTTCTACCCCCATCATTTTTATTATTAATCGCCTCTGCGGGTGTAGAGAGTGGAGTTGGAACTGGATGAACTTTGTACCCCCCTTTATCTAACAACTTAGCCCACGCGGGGGGGAGTGTAGACTTAGCAATTTTCTCATTACATTTAGCCGGAGCATCCTCAATTTTAGGTGCCGCAAATTTCATCACCACATCTATTAACATACGAGCACCAGGAATCACTCTAGACCGACTACCTTTATTTGTGTGGTCCGTCATCATCACCGCCATTCTACTCCTTTTACCACTACCTGTATTAGCAGGAGGCATCACTATATTACTTACAGATCGAAATCTAAACACTTCATTCTTTGACCCAGCAGGAGGAGGAGATCCAGTATTATTTCAACACTTRTTCTGATTCTTCGGTCACCCAGRAGTATATATTTTAATCTTACCAGCATTCGGAATAGTATCACACATCATCGCATATTACACAGGAAAAAAAGAACCATTCGGTTATCTAGGTATAGTTTATGCTATAGCAGCAATTGGATTACTAGGATTCCTAGTGTGAGCACATCACATATACACCGTAGGTATAGACGTCGACACTCGAG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|