Barcode Identifiers

Sequence ID: GBSP1286-06
Sample ID: DQ320485
Identified As: Dollfusentis chandleri
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 513
TTAGAACTAGGTAGTGGTGGGTTGTTAATTGGTGAT---GAGCATTTATATAATGTGTTAGTTACGAGTCATGCCATTATGATGGTCTTTTTCTTAGTAATACCTCTGTTTATAGGGGGTTTTGGTAATTGGATAATCCCTGTGATAGTGGGGTGTAGGGATATGTTATTCCCTCGTTTAAATAATTTAAGGTTTTTACTAGTTCCTATAAGGTTGGTATTATTTTTAGTGTCTATATATTTAGAGGGGGGTGGTGGA---GGATGGACTATGTACCCACCCTTAATTTTAAGAAGGTACAGTCCTAGGATGTCTGTAGATATAATGGTGTTAAGTCTTCATATAGCAGGCCTATCTTCATTGTTAGGGTCAATTAATATTATTTTGACAAGAGTTATAGTTAGAGTTCTTCATGGGTTGGGGGAGACTATCCCATTGTTGGTGTGGTCTTTACTAGTTACTGCTGGATTGGTTGTTTTAACTGTACCTGTCCTAGCTGCAGCTTTTACTATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||