Barcode Identifiers

Sequence ID: GBSP1225-06
Sample ID: DQ133898
Identified As: Tedania klausi
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 660
ACTTTATATTTGTTATTTGGTGGTTTTGCTGGGATGATAGGGACAGCCTTTAGTATGTTAATAAGGTTAGAGTTATCTGCTCCAGGGTCAATGTTAAGTGAT---GATCATTTATATAATGTTATTGTGACAGCCCATGCTTTTGTTATGATTTTTTTTTTAGTTATGCCAGTGATGATTGGTGGATTTGGGAATTGGTTTGTGCCTGTGTATATTGGTGCGCCGGATATGGCTTTTCCTCGTTTAAATAATATAAGTTTTTGGTTATTGCCTCCAGCTTTAAGTTTATTATTGGCTTCTGCTTTTGTGGAGCAAGGGGCAGGTACCGGGTGGACAGTATATCCCCCATTATCTGGGATTCAGGCTCATTCCGGGGGTTCGGTAGATTTGGTTATTTTTAGTTTACATTTAGCGGGAATTTCTTCTATATTGGGGGCTATGAATTTTATAACCACTATAATTAATATGAGGGCACCAGGGATAACAATGGATAGAACGCCATTGTTTGTTTGGTCAATTTTAGTAACTGCGGTTTTATTATTATTATCTTTACCGGTGTTAGCAGGCGCAATTACTATGTTATTAACGGATAGAAATTTTAATACTGCTTTTTTTGATCCAGCAGGTGGAGGGGACCCGATTTTATATCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||