Barcode Identifiers

Sequence ID: GBSP1217-06
Sample ID: DQ087502
Identified As: Priapulus caudatus
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 684
ACAATATATTTAATTTTTGGATTTTGATCTGCCATAGTTGGTTCAGGGTTAAGTTTAATTATTCGAGCTGAACTCGGGCAAGCAGGCTCCCTTCTAGGAGAC---GATCACCTATATAATGTGATTGTTACTGCCCACGCATTTGTAATGATTTTTTTTATAGTAATGCCTATTTTAATTGGGGGTTTTGGTAACTGAATGCTTCCATTAATATTAGGAGCACCAGACATAGCCTTTCCACGATTAAACAATTTAAGTTTCTGATTATTACCACCCTCATTAACGCTTCTTTTAGCCTCTTCTTTAGTAGAAGCAGGTGCTGGGACTGGTTGGACTGTTTACCCCCCTCTAGCTAGAAATATTGCTCACGCCGGTGGCTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGTGCTTCTTCCATTTTAGGAGCAGTAAATTTTATTACAACAGTGATTAATATACGTACTGAGGGGATAGTTTTTGAGCGAATCCCGCTTTTTGTTTGAGCAGTCAAAATCACAGTTGTTTTACTTCTTCTTTCACTCCCAGTCCTTGCTGGGGCAATCACTATATTATTGACAGATCGAAATCTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGACCCTATTCTGTACCAACATCTTTTTTGATTTTTTGGTCACCCTGAAGTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||