Barcode Identifiers

Sequence ID: GBSP1203-06
Sample ID: DQ079972
Identified As: Valvognathia pogonostoma
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 657
ACAAACTACTTGTGATATGGACTCACCACTGGGTTTGTAGCAGCAGGACTAAGTATAATCATCCGTATAGAACTTGGTACAACAGGTTCAATCATAATAAAT---GATCATACTTATAATACAGTAATTACTGCACATGGCCTTTTAATACTTTTTTTTGTTGTCACCCCCGTGTTAATAGGAAGATATGGAAATTTTTTTATCCCACTTATACTAAGAGCTCCCGATATAGCGTTCCCTCGACTTAATAACTTAAGTTTTTGAATAGCTATTCCTGCATTTTTATTACTCTTAAGAAGAAGAATAATAGAAGGAGGAGCAGGAACAGGTTGAACTGTATACCCACCACTGTCAAGCATTGAATTTCATAGAAGAATTGCAGTTGATCTAGCTATTTTTTCTTTACATTTCTCCGGAATATCACTTATTTTAGGATCAATTAATTTTATTGCCACTATCTTTAATATACGTTCCAATTCTCTTCTTTTTACGCGAATCAATCTATTCTCATGATCGATTTTAATTACAGCAATTCTCCTAGTTACAGCACTCCCAGTTTTTGCAGGTGCGATTACAATACTTCTTGTAGACCGTAATTTTAATTGCTCATTTTTTGACCCCATAGGAGGTGGTAGGATTATCCTTTACCAGCATTTA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||