Barcode Identifiers

Sequence ID: GBSP1028-06
Sample ID: DQ069300
Identified As: Agelas gracilis
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 642
TTATTATTAGGAGCCTTTAGCGGAATGATAGGAACAGCCTTTAGTGTGCTTATTAGGTTAGAATTATCGGCTCCGGGCTCAATGCTAGGTGAT---GATCAGCTTTACAATGTTATAGTAACCGCTCATGCTTTTGTAATGATATTTTTTTTAGTTATGCCGGTCTTAATCGGGGGTTTTGGTAACTGATTTGTACCTCTTTATATAGGGGCCCCCGATATGGCTTTTCCCCGGCTTAATAATATCAGTTTTTGATTATTGCCACCTTCTTTAACTCTATTACTTGGTTCCGCTTTTGTAGAACAAGGGGCGGGGACTGGGTGAACTGTCTATCCACCCTTAGCAAGTATACAGGCTCACTCTGGTGGATCTGTGGATATGGTGATTTTTAGTCTTCACTTAGCTGGAATTTCCTCTATTCTAGGGGCAATGAATTTTATTACAACTATATTTAATATGCGAGCACCTGGGATAACATTAGATAGAATGCCCCTATTTGTATGATCTATTTTAGTTACGGTCTTTTTATTGTTATTGTCTTTGCCGGTGTTGGCGGGGGCAATCACTATGCTTTTAACCGATAGAAATTTTAATACTACATTTTTTGACCCAGCCGGAGGGGGGGACCCTATTTTATACCAA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||