Barcode Identifiers

Sequence ID: GBSP1026-06
Sample ID: DQ069298
Identified As: Agelas axifera
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 642
TTATTATTAGGAGCCTTTAGCGGAATGATAGGAACAGCCTTTAGTGTGCTTATTAGATTAGAGTTATCGGCTCCGGGGTCAATGTTAGGTGAT---GACCAACTTTATAATGTGATAGTAACTGCTCATGCTTTTGTAATGATTTTTTTCTTAGTTATGCCGGTTTTAATCGGGGGGTTTGGTAACTGATTTGTACCCCTTTATATAGGGGCCCCCGATATGGCTTTTCCTCGGCTTAATAATATCAGTTTTTGATTATTGCCGCCCTCTTTAACTCTATTACTTGGTTCCGCTTTTGTAGAGCAAGGGGCGGGGACCGGATGAACTGTCTATCCGCCATTAGCAAGTATACAAGCTCACTCGGGTGGGTCCGTGGATATGGTGATTTTTAGTCTTCACTTAGCAGGGATATCCTCTATTTTAGGAGCAATGAATTTTATTACAACTATTTTTAATATGCGAGCACCCGGGGTAACATTAGATAGAATGCCTTTATTTGTATGATCTATTTTAGTTACGGTTTTTTTATTGTTGTTGTCTTTGCCTGTGTTGGCGGGGGCAATTACTATGCTTTTAACCGATAGAAACTTTAATACTACATTTTTTGATCCCGCAGGTGGGGGGGACCCTATTTTATACCAA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||