Barcode Identifiers

Sequence ID: GBSP0932-06
Sample ID: AY790773
Identified As: Symbion pandora
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 489
GGGTCTTTATTGGGTGAC---GATCAAATTTATAATGTCGTTATTACTGGTCATGGATTTATTATGATTTTCTTTTTTGTAATACCAATTTTAATTGGTGGGTTTGGTAATTTTTTAGTACCTCTTATACTCTTATCTCCAGATATGTGTTTTCCGCGTATAAATAACCTATCCTTTTGGCTTCTACCCCCTGCGTTATCTTTATTGTTATTATCTACTTTAGTTTCCACAGGTGCTGGTACTGGGTGAACAATTTATCCACCTTTATCT------TTTCAACATAGAGGAAGTTCTGTCGATTTAGCTATTTTTTCTATACATCTAGCAGGTGTTTCCTCATTATTAGGTGCTGTTAATTTTATTTCTACAATTCTCAATATACGAGTAGCAGGAATGCCTATATTTAAACTTCCCTTATTCGTGTGATCTGTTCTTATTACAGCTGTTCTATTATTGTTATCTTTACCTGTGTTTGCAGGTGCTATT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||