Barcode Identifiers

Sequence ID: GBSP0895-06
Sample ID: AY790736
Identified As: Symbion pandora
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 495
GGGTCTTTATTGGGTGAC---GATCAAATTTATAATGTCATTATTACTGGTCATGGATTTATTATGATTTTCTTTTTTGTAATACCAATTTTAATTGGTGGGTTTGGTAATTTTTTAGTACCTCTTATACTCTTATCTCCAGATATGTGTTTTCCGCGTATAAATAACCTATCCTTTTGACTTCTACCCCCTGCGTTATCTTTATTGTTATTATCTACTTTAGTTTCCACAGGTGCTGGTACTGGGTGAACAATTTATCCACCTTTATCT------TTCCAACATAGAGGAAGTTCTGTCGATTTAGCTATTTTTTCTATACATCTAGCAGGTGTTTCCTCATTATTAGGTGCTGTTAATTTTATTTCTACAATTCTCAATATACGAGTAGCAGGAATGCCTATATTTAAACTTCCCTTATTCGTGTGATCTGTTCTTATTACAGCTGTTCTATTATTATTATCTTTACCTGTATTTGCAGGTGCTATTACGATG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||