Barcode Identifiers

Sequence ID: GBSP0662-06
Sample ID: AY690514
Identified As: Leptorhynchoides thecatus
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 820
TTTAGATTAAGTGTCATTATTCGGCTAGAGTTAGGTGGGGGTGGGATTATCTTAGGGGAT---GAGCATCTATATAATGTTTTGGTAACAAGACATGCTGTGATGATAGTATTTTTTCTCGTCATACCTCTGTTTATAGGTGGTTTTGGTAATTGGTTAATACCTGTTATGTTAGGTTGTAGGGATATACTATTACCACGATTGAATAATTTAAGTTTTTTAATGGTCCCTATTAGTATATTAGTTTTTTTAAGCTCTTTAGTGTTAGAGGGGGGA---GGTGCAGGATGAACTATATACCCTCCTTTAGTCTTAGTAGATTTTAGTAGTGGGATCTCTATGGATATAATAATTTTAAGTTTACACATTGCAGGTTTATCTTCTATTTTAGGTTCTATTAATATTATATTAACAGGAATTTTAGTTAGATTTTTTGGG---GGTAGTGAGAGTATCCCCTTACTAGTATGATCTATAATAGTTACTGCAGGTCTGGYTATTTTGACAGTGCCTGTACTTGCTGCAGCTTTAACAATACTTCTATTAGATCGAAATTTTATAACTAGTTTTTTTGATCCTGTGGGAGGGGGGAGACCTTTATTATATCAACATCTATTTTGGTTTTTTGGGCACCCAGAAGTGTATATTTTGATTTTACCTGGTTTTGGTATTATTTCTCATGTAATTGTAGAGATAGGGGGTAAGTTTGAAGTCTTTGGTTATTTRGGTATAGTCTATGCTATAYTAAGTATTGGGGTATTGGGTAGTYTAGTGTGGGCTCATCATATATTTACAGTTGGTTTAGATATTGACACACGTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||