Barcode Identifiers

Sequence ID: GBSP0595-06
Sample ID: AY598777
Identified As: Xerobiotus pseudohufelandi
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 618
GGGCTGTGAGCTGCTTGTGCTGGCACTTCACTAAGATTTATTATTCGAAGAGAATTAAGACAACCTGGCCTACTTTTTTCTGAC---GAGCAAATATATAATGTAACTGTAACTAGACATGCTTTCATCATAATTTTTTTCTTTGTTATGCCGACCCTTATTGGAGGTTTCGGCAACTGATTAGTGCCTCTAATAATTAGAGCGCCCGACATGGCCTTCCCTCGAATAAATAACTTAAGATTTTGACTTCTCCCCCCTTCATTATTGTTAATTATGTCTAGTACAATAAGAGAACAGGGGGCCGGGACAGGCTGAACAGTATACCCGCCCTTGTCCCACTTCTTTGCCCACAGAGGCCCGAGAGTAGATTTAACAATTTTTTCCCTTCACGTAGCTGGGGTGTCGTCAATTCTAGGTGCAATTAATTTCATTTCTACTATTATTAATATGCGAGCTCCAGCCATTTCACTTGAAAAAATACCACTCTTCGTGTGAAGCGTGTTAATTACCGCTATTCTCCTTTTGCTAGCTCTTCCTGTACTAGCAGGAGCTATTACAATGCTTTTAATGGATCGAAATTTTAATACTTCCTTTTTCGATCCTGCTGGAGGGGGAGAC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||