Barcode Identifiers

Sequence ID: GBSP0594-06
Sample ID: AY598776
Identified As: Xerobiotus pseudohufelandi
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 633
TTTGGGCTGTGGGCTGCTTGTGCTGGCACTTCACTAAGATTTATTATTCGAAGAGAATTAAGACAACCTGGCCTACTTTTTTCTGAC---GAACAAATATATAATGTAACTGTAACTAGACATGCTTTTATCATAATTTTTTTCTTTGTTATGCCAACCCTTATTGGAGGTTTCGGCAATTGATTAGTGCCTCTAATAATTAGAGCACCAGACATGGCCTTCCCTCGAATAAATAACTTAAGATTTTGACTTCTCCCTCCTTCATTATTGTTAATCATGTCTAGTACAATGAGAGAACAGGGGGCCGGGACAGGGTGAACAGTATACCCACCCCTGTCCCACTTCTTTGCCCACAGAGGCCCGAGAGTAGATTTAACAATTTTTTCCCTTCACGTAGCTGGGGTGTCGTCAATTCTAGGTGCAATTAATTTCATTTCTACTATTATTAATATGCGGGCTCCAGCCATTTCACTTGAAAAAATACCACTCTTCGTGTGAAGTGTGTTAATTACTGCTATTCTTCTTTTGCTAGCTCTTCCTGTACTAGCAGGAGCTATTACAATGCTTTTAATGGATCGAAATTTTAACACTTCCTTTTTTGATCCTGCTGGAGGTGGAGATCCTATTTTATAC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||