Barcode Identifiers

Sequence ID: GBSP0589-06
Sample ID: AY598771
Identified As: Dactylobiotus parthenogeneticus
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 627
TTTGGGCTATGAGCAGCCACAGTTGGGACATCCCTAAGCTTTATTATTCGATCAGAATTAAGCCAACCAGGCTCAATTCTAAACGAT---GACCAAATATACAACGTAATTGTAACAAGACATGCTTTTATCATAATTTTCTTCTTTGTAATACCTATTTTAATTGGGGGGTTTGGAAACTGATTAGTCCCCCTAATGATTGGAGCCCCAGACATAGCGTTCCCACGAATAAACAACTTAAGATTCTGATTACTACCGCCATCCTTCTTACTAATCACAAGAGGTACCATAAGAGAACAAGGGGCAGGCACAGGATGAACAGTGTATCCACCACTCTCTCAATATTTTGCCCACAGAGGACCAAGAGTAGACCTAACCATCTTCTCTTTACACATTGCAGGAATCTCCTCTATCTTAGGAGCAATTAACTTTATCTCCACAATTATCAATATACGATCTCCAGCCATAAGAATAGAAAACATACCCTTATTTGTATGATCAGTGCTAATCACAGCAATCCTACTATTACTAGCATTACCAGTACTTGCAGGTGGAATTACAATACTGCTACTAGACCGTAACTTCAATACCTCATTCTTTGATCCTGCGGGGGGAGGTGACCCAATT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||