Barcode Identifiers

Sequence ID: GBSP0577-06
Sample ID: AY561978
Identified As: Tethya californiana
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 708
TCAACAAATCATAAAGATATTGGGACTCTTTATTTATTATTTGGGGCATTTGCAGGAATGATAGGAACAGGATTTAGTATGTTAATTAGGCTTGAATTATCTGCTCCTGGCTCAATGTTGGGAGAT---GACCATTTGTATAATGTAATTGTGACAGCTCATGCCTTTGTAATGATATTTTTTTTAGTAATGCCAGTAATGATTGGGGGGTTTGGAAATTGATTTGTGCCATTATATATTGGTGCACCAGATATGGCATTTCCTAGATTAAATAATATAAGTTTTTGGTTATTGCCTCCTTCGTTAACTTTATTATTGGGTTCTGCTTTTGTGGAACAAGGAGCTGGAACTGGGTGGACAGTTTATCCACCTTTAGCAAGTATACAGGCTCATTCAGGAGGATCAGTAGATATGGCAATATTTAGTTTACATTTAGCCGGGATTTCTTCAATTTTAAGTACAATAAATTTTATAACAACAATTTTAAATATGAGGGCACCGGGTATAACAATGGATAGAATGCCACTATTTGTTTGATCAATTTTAGTTACAGTAGTTTTATTATTATTATCTTTACCTGTTTTAGCGGGTGCTATTACAATGCTTCTTACAGACAGAAATTTTAATACAGCATTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||